Orthologous regulated operons containing treF gene

Properties
Regulog:	TreR - Thermoanaerobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Firmicutes

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermoanaerobacter ethanolicus X514
Position: -74 Score: 6.61324 Sequence: AATTGTAAGCGCTTACAGTT Locus tag: Teth514_2196 Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1 Locus tag: Teth514_2195 Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2 Locus tag: Teth514_2194 Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein Locus tag: Teth514_2193 Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP	-74	6.6	AATTGTAAGCGCTTACAGTT	Teth514_2196
Thermoanaerobacter italicus Ab9
Position: -77 Score: 6.20408 Sequence: GATTGTAAGCGCTTACAGTT Locus tag: Thit_0761 Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1 Locus tag: Thit_0762 Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2 Locus tag: Thit_0763 Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein Locus tag: Thit_0764 Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP	-77	6.2	GATTGTAAGCGCTTACAGTT	Thit_0761
Thermoanaerobacter tengcongensis MB4
Position: -63 Score: 6.08643 Sequence: AACTGTAAGCGCTTTCAATA Locus tag: TTE0804 Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1 Locus tag: TTE0805 Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2 Locus tag: TTE0806 Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein Locus tag: TTE0807 Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP	-63	6.1	AACTGTAAGCGCTTTCAATA	TTE0804