Regulon of TreR in Thermoanaerobacter ethanolicus X514

Properties
Regulator type:	Transcription factor
TF locus tag:	Teth514_2197
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 7.1 Sequence: AACTGTAAGCGGTTACAGTA Locus tag: Teth514_2197 Name: treR Funciton: Predicted trehalose utilization transcriptional regulator, LacI family
	Teth514_2197	treR	Predicted trehalose utilization transcriptional regulator, LacI family
Position: -74 Score: 6.6 Sequence: AATTGTAAGCGCTTACAGTT Locus tag: Teth514_2196 Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1 Locus tag: Teth514_2195 Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2 Locus tag: Teth514_2194 Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein Locus tag: Teth514_2193 Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64)
	Teth514_2196	treF	Predicted trehalose utilization ABC transporter, permease protein 1
	Teth514_2195	treG	Predicted trehalose utilization ABC transporter, permease protein 2
	Teth514_2194	treE	Predicted trehalose utilization ABC transporter, substrate-binding protein
	Teth514_2193	treP	Trehalose phosphorylase (EC 2.4.1.64)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD