Regulog KojR - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Kojibiose utilization |
| Effector: | Kojibiose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - LacI
- By effector - Kojibiose
- By pathway - Kojibiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | 6 | 2 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | 6 | 2 |
| Carboxydothermus hydrogenoformans Z-2901 | ||
| Moorella thermoacetica ATCC 39073 | ||
| Thermoanaerobacter ethanolicus X514 | 6 | 2 |
| Thermoanaerobacter italicus Ab9 | 6 | 2 |
| Thermoanaerobacter tengcongensis MB4 | 6 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| kojP |
Gene: Athe_0398: Kojibiose phosphorylase (EC 2.4.1.230) |
Gene: Csac_0439: Kojibiose phosphorylase (EC 2.4.1.230) |
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -51 score = 6.21073 sequence = TACCCAAAACGTTTCGGATA Gene: Teth514_2202: Kojibiose phosphorylase (EC 2.4.1.230) |
*
Thermoanaerobacter italicus Ab9 Site: position = -49 score = 6.31471 sequence = TATCCAAAACGTTTCGGATA Gene: Thit_0754: Kojibiose phosphorylase (EC 2.4.1.230) |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -45 score = 6.26502 sequence = CATCCAAAACGTTTCGGATA Gene: TTE0798: Kojibiose phosphorylase (EC 2.4.1.230) |
Kojibiose phosphorylase (EC 2.4.1.230) |
| kojE |
*
Anaerocellum thermophilum DSM 6725 Site: position = -181 score = 5.13323 sequence = TTACGAAAACATTTCGAAAA Site: position = -48 score = 5.60606 sequence = CATCGAAAACATTTCCGAAA Gene: Athe_0399: Kojibiose ABC transporter, substrate-binding protein |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -53 score = 5.1531 sequence = TGTCGAAAACATTTCCGAAA Gene: Csac_0440: Kojibiose ABC transporter, substrate-binding protein |
|
|
Gene: Teth514_2201: Kojibiose ABC transporter, substrate-binding protein |
Gene: Thit_0755: Kojibiose ABC transporter, substrate-binding protein |
Gene: TTE0799: Kojibiose ABC transporter, substrate-binding protein |
Kojibiose ABC transporter, substrate-binding protein |
| kojF |
Gene: Athe_0400: Kojibiose ABC transporter, permease protein 1 |
Gene: Csac_0441: Kojibiose ABC transporter, permease protein 1 |
|
|
Gene: Teth514_2200: Kojibiose ABC transporter, permease protein 1 |
Gene: Thit_0756: Kojibiose ABC transporter, permease protein 1 |
Gene: TTE0800: Kojibiose ABC transporter, permease protein 1 |
Kojibiose ABC transporter, permease protein 1 |
| kojG |
Gene: Athe_0401: Kojibiose ABC transporter, permease protein 2 |
Gene: Csac_0442: Kojibiose ABC transporter, permease protein 2 |
|
|
Gene: Teth514_2199: Kojibiose ABC transporter, permease protein 2 |
Gene: Thit_0757: Kojibiose ABC transporter, permease protein 2 |
Gene: TTE0801: Kojibiose ABC transporter, permease protein 2 |
Kojibiose ABC transporter, permease protein 2 |
| pgmB |
*
Anaerocellum thermophilum DSM 6725 Site: position = -70 score = 4.79936 sequence = TATTGAAAACAATTCGAAAA Gene: Athe_0397: Beta-phosphoglucomutase (EC 5.4.2.6) |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -71 score = 4.79936 sequence = TATTGAAAACAATTCGAAAA Gene: Csac_0438: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
Gene: Teth514_2198: Beta-phosphoglucomutase (EC 5.4.2.6) |
Gene: Thit_0758: Beta-phosphoglucomutase (EC 5.4.2.6) |
Gene: TTE0802: Beta-phosphoglucomutase (EC 5.4.2.6) |
Beta-phosphoglucomutase (EC 5.4.2.6) |
| kojR |
Gene: Athe_0402: Kojibiose utilization transcriptional regulator KojR, LacI family |
Gene: Csac_0443: Kojibiose utilization transcriptional regulator KojR, LacI family |
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -33 score = 6.65503 sequence = CAACCAAAACGTTTTGGAAA Gene: Teth514_2203: Kojibiose utilization transcriptional regulator KojR, LacI family |
*
Thermoanaerobacter italicus Ab9 Site: position = -33 score = 6.65503 sequence = CAACCAAAACGTTTTGGAAA Gene: Thit_0753: Kojibiose utilization transcriptional regulator KojR, LacI family |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -31 score = 6.41169 sequence = TAACCAAAACGTTTTGGGAA Gene: TTE0797: Kojibiose utilization transcriptional regulator KojR, LacI family |
Kojibiose utilization transcriptional regulator KojR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |