Regulon of KojR in Thermoanaerobacter italicus Ab9

Properties
Regulator type:	Transcription factor
TF locus tag:	Thit_0753
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.3 Sequence: TATCCAAAACGTTTCGGATA Locus tag: Thit_0754 Name: kojP Funciton: Kojibiose phosphorylase (EC 2.4.1.230) Locus tag: Thit_0755 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: Thit_0756 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: Thit_0757 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2 Locus tag: Thit_0758 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	Thit_0754	kojP	Kojibiose phosphorylase (EC 2.4.1.230)
	Thit_0755	kojE	Kojibiose ABC transporter, substrate-binding protein
	Thit_0756	kojF	Kojibiose ABC transporter, permease protein 1
	Thit_0757	kojG	Kojibiose ABC transporter, permease protein 2
	Thit_0758	pgmB	Beta-phosphoglucomutase (EC 5.4.2.6)
Position: -33 Score: 6.7 Sequence: CAACCAAAACGTTTTGGAAA Locus tag: Thit_0753 Name: kojR Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
	Thit_0753	kojR	Kojibiose utilization transcriptional regulator KojR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD