Regulon of KojR in Thermoanaerobacter tengcongensis MB4

Properties
Regulator type:	Transcription factor
TF locus tag:	TTE0797
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 6.4 Sequence: TAACCAAAACGTTTTGGGAA Locus tag: TTE0797 Name: kojR Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
	TTE0797	kojR	Kojibiose utilization transcriptional regulator KojR, LacI family
Position: -45 Score: 6.3 Sequence: CATCCAAAACGTTTCGGATA Locus tag: TTE0798 Name: kojP Funciton: Kojibiose phosphorylase (EC 2.4.1.230) Locus tag: TTE0799 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: TTE0800 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: TTE0801 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2 Locus tag: TTE0802 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	TTE0798	kojP	Kojibiose phosphorylase (EC 2.4.1.230)
	TTE0799	kojE	Kojibiose ABC transporter, substrate-binding protein
	TTE0800	kojF	Kojibiose ABC transporter, permease protein 1
	TTE0801	kojG	Kojibiose ABC transporter, permease protein 2
	TTE0802	pgmB	Beta-phosphoglucomutase (EC 5.4.2.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD