Regulog Rmet_4647 - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI

Statistics of regulated genes
Genome	Genes	Operons
Cupriavidus taiwanensis
Ralstonia eutropha H16
Ralstonia eutropha JMP134	8	2
Ralstonia metallidurans CH34	4	2
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
Rmet_4645	Cupriavidus taiwanensis	Ralstonia eutropha H16	2 Ralstonia eutropha JMP134* Site: position = -66 score = 6.40983 sequence = ATCTGAAAACGTTTTCCGAA Gene: Reut_A1197: Putative extra-cytoplasmic solute receptor Gene: Reut_A1191: Putative extra-cytoplasmic solute receptor	2 Ralstonia metallidurans CH34 Gene: Rmet_4645: Putative extra-cytoplasmic solute receptor Gene: Rmet_4951: Putative extra-cytoplasmic solute receptor	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Putative extra-cytoplasmic solute receptor
PF00501	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_A1196: AMP-dependent synthetase and ligase	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	AMP-dependent synthetase and ligase
Rmet_4646	Cupriavidus taiwanensis	Ralstonia eutropha H16	2 Ralstonia eutropha JMP134 Gene: Reut_A1195: Probable short-chain dehydrogenase Gene: Reut_A1192: Probable short-chain dehydrogenase	* Ralstonia metallidurans CH34 Site: position = 54 score = 5.68065 sequence = CACGGAAAACGATTCCACAT Gene: Rmet_4646: Probable short-chain dehydrogenase	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Probable short-chain dehydrogenase
COG0372	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_A1194: Predicted citrate synthase	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Predicted citrate synthase
PF02627	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_A1193: Putative decarboxylase	Ralstonia metallidurans CH34 Gene: Rmet_4644: Putative decarboxylase	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Putative decarboxylase

CRON 2.
Rmet_4647	Cupriavidus taiwanensis	Ralstonia eutropha H16	* Ralstonia eutropha JMP134 Site: position = -108 score = 6.40983 sequence = TTCGGAAAACGTTTTCAGAT Gene: Reut_A1198: Predicted transcriptional regulator, LacI family	* Ralstonia metallidurans CH34 Site: position = -85 score = 5.68065 sequence = ATGTGGAATCGTTTTCCGTG Gene: Rmet_4647: Predicted transcriptional regulator, LacI family	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Predicted transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Rmet_4647 - Ralstonia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --