Regulog Rmet_4647 - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
| Genome | Genes | Operons |
|---|---|---|
| Cupriavidus taiwanensis | ||
| Ralstonia eutropha H16 | ||
| Ralstonia eutropha JMP134 | 8 | 2 |
| Ralstonia metallidurans CH34 | 4 | 2 |
| Ralstonia pickettii 12J | ||
| Ralstonia solanacearum GMI1000 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| Rmet_4645 |
|
|
*2
Ralstonia eutropha JMP134 Site: position = -66 score = 6.40983 sequence = ATCTGAAAACGTTTTCCGAA Gene: Reut_A1197: Putative extra-cytoplasmic solute receptor Gene: Reut_A1191: Putative extra-cytoplasmic solute receptor |
2
Ralstonia metallidurans CH34 Gene: Rmet_4645: Putative extra-cytoplasmic solute receptor Gene: Rmet_4951: Putative extra-cytoplasmic solute receptor |
|
|
Putative extra-cytoplasmic solute receptor |
| PF00501 |
|
|
Gene: Reut_A1196: AMP-dependent synthetase and ligase |
|
|
|
AMP-dependent synthetase and ligase |
| Rmet_4646 |
|
|
2
Ralstonia eutropha JMP134 Gene: Reut_A1195: Probable short-chain dehydrogenase Gene: Reut_A1192: Probable short-chain dehydrogenase |
*
Ralstonia metallidurans CH34 Site: position = 54 score = 5.68065 sequence = CACGGAAAACGATTCCACAT Gene: Rmet_4646: Probable short-chain dehydrogenase |
|
|
Probable short-chain dehydrogenase |
| COG0372 |
|
|
Gene: Reut_A1194: Predicted citrate synthase |
|
|
|
Predicted citrate synthase |
| PF02627 |
|
|
Gene: Reut_A1193: Putative decarboxylase |
Gene: Rmet_4644: Putative decarboxylase |
|
|
Putative decarboxylase |
| CRON 2. | |||||||
| Rmet_4647 |
|
|
*
Ralstonia eutropha JMP134 Site: position = -108 score = 6.40983 sequence = TTCGGAAAACGTTTTCAGAT Gene: Reut_A1198: Predicted transcriptional regulator, LacI family |
*
Ralstonia metallidurans CH34 Site: position = -85 score = 5.68065 sequence = ATGTGGAATCGTTTTCCGTG Gene: Rmet_4647: Predicted transcriptional regulator, LacI family |
|
|
Predicted transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |