Regulon of Rmet_4647 in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_A1198
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Rmet_4647 - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.4 Sequence: ATCTGAAAACGTTTTCCGAA Locus tag: Reut_A1197 Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor Locus tag: Reut_A1196 Name: PF00501 Funciton: AMP-dependent synthetase and ligase Locus tag: Reut_A1195 Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase Locus tag: Reut_A1194 Name: COG0372 Funciton: Predicted citrate synthase Locus tag: Reut_A1193 Name: PF02627 Funciton: Putative decarboxylase Locus tag: Reut_A1192 Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase Locus tag: Reut_A1191 Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor
	Reut_A1197	Rmet_4645	Putative extra-cytoplasmic solute receptor
	Reut_A1196	PF00501	AMP-dependent synthetase and ligase
	Reut_A1195	Rmet_4646	Probable short-chain dehydrogenase
	Reut_A1194	COG0372	Predicted citrate synthase
	Reut_A1193	PF02627	Putative decarboxylase
	Reut_A1192	Rmet_4646	Probable short-chain dehydrogenase
	Reut_A1191	Rmet_4645	Putative extra-cytoplasmic solute receptor
Position: -108 Score: 6.4 Sequence: TTCGGAAAACGTTTTCAGAT Locus tag: Reut_A1198 Name: Rmet_4647 Funciton: Predicted transcriptional regulator, LacI family
	Reut_A1198	Rmet_4647	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD