Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator Rmet_4647 in Ralstonia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: Rmet_4647 - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia eutropha JMP134
Reut_A1198 Rmet_4647 -108 6.4 TTCGGAAAACGTTTTCAGAT
Reut_A1197 Rmet_4645 -66 6.4 ATCTGAAAACGTTTTCCGAA
Ralstonia metallidurans CH34
Rmet_4647 Rmet_4647 -85 5.7 ATGTGGAATCGTTTTCCGTG
Rmet_4646 Rmet_4646 54 5.7 CACGGAAAACGATTCCACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD