Regulon of Rmet_4647 in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_4647
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Rmet_4647 - Ralstonia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: 54 Score: 5.7 Sequence: CACGGAAAACGATTCCACAT Locus tag: Rmet_4646 Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase Locus tag: Rmet_4645 Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor Locus tag: Rmet_4644 Name: PF02627 Funciton: Putative decarboxylase
	Rmet_4646	Rmet_4646	Probable short-chain dehydrogenase
	Rmet_4645	Rmet_4645	Putative extra-cytoplasmic solute receptor
	Rmet_4644	PF02627	Putative decarboxylase
Position: -85 Score: 5.7 Sequence: ATGTGGAATCGTTTTCCGTG Locus tag: Rmet_4647 Name: Rmet_4647 Funciton: Predicted transcriptional regulator, LacI family
	Rmet_4647	Rmet_4647	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD