Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF00501 gene

Properties
Regulog: Rmet_4647 - Ralstonia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/beta
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha JMP134
Position: -66
Score: 6.40983
Sequence: ATCTGAAAACGTTTTCCGAA
Locus tag: Reut_A1197
Name: Rmet_4645
Funciton: Putative extra-cytoplasmic solute receptor
Locus tag: Reut_A1196
Name: PF00501
Funciton: AMP-dependent synthetase and ligase
Locus tag: Reut_A1195
Name: Rmet_4646
Funciton: Probable short-chain dehydrogenase
Locus tag: Reut_A1194
Name: COG0372
Funciton: Predicted citrate synthase
Locus tag: Reut_A1193
Name: PF02627
Funciton: Putative decarboxylase
Locus tag: Reut_A1192
Name: Rmet_4646
Funciton: Probable short-chain dehydrogenase
Locus tag: Reut_A1191
Name: Rmet_4645
Funciton: Putative extra-cytoplasmic solute receptor
Rmet_4645-PF00501-Rmet_4646-COG0372-PF02627-Rmet_4646-Rmet_4645 -66 6.4 ATCTGAAAACGTTTTCCGAA Reut_A1197