Regulog MalR2 - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | 6 | 2 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | 6 | 2 |
| Carboxydothermus hydrogenoformans Z-2901 | ||
| Moorella thermoacetica ATCC 39073 | ||
| Thermoanaerobacter ethanolicus X514 | 6 | 3 |
| Thermoanaerobacter italicus Ab9 | 6 | 3 |
| Thermoanaerobacter tengcongensis MB4 | 6 | 3 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| TTE1813 |
|
|
|
|
|
|
*
Thermoanaerobacter tengcongensis MB4 Site: position = -40 score = 5.24675 sequence = TATAACAAACGTTTGCACAA Gene: TTE1813: Glucoamylase (EC 3.2.1.3) |
Glucoamylase (EC 3.2.1.3) |
| CRON 2. | ||||||||
| glgB |
|
|
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -96 score = 4.94036 sequence = TTATGAAAGCGATTGCCTAA Site: position = -154 score = 5.64174 sequence = TTGCGCAAAAATTTGCACAA Gene: Teth514_1781: Alpha amylase, catalytic region |
*
Thermoanaerobacter italicus Ab9 Site: position = -153 score = 5.01998 sequence = TTGCGCAAAAAATTGCACAG Site: position = -96 score = 5.47766 sequence = TTGTGAAAGCGATTGCTTAA Gene: Thit_0062: Alpha amylase, catalytic region |
|
Alpha amylase, catalytic region |
| CRON 3. | ||||||||
| malF |
*
Anaerocellum thermophilum DSM 6725 Site: position = -45 score = 5.84221 sequence = AAGAGCAAACGATTGCACAT Gene: Athe_2578: Maltose/maltodextrin ABC transporter, permease protein 1 |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -46 score = 5.63904 sequence = AAGAGCAAACGATTGCACAC Gene: Csac_0427: Maltose/maltodextrin ABC transporter, permease protein 1 |
|
|
Gene: Teth514_1182: Maltose/maltodextrin ABC transporter, permease protein 1 |
Gene: Thit_1642: Maltose/maltodextrin ABC transporter, permease protein 1 |
Gene: TTE1830: Maltose/maltodextrin ABC transporter, permease protein 1 |
Maltose/maltodextrin ABC transporter, permease protein 1 |
| malG |
Gene: Athe_2577: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: Csac_0428: Maltose/maltodextrin ABC transporter, permease protein 2 |
|
|
Gene: Teth514_1183: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: Thit_1641: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: TTE1829: Maltose/maltodextrin ABC transporter, permease protein 2 |
Maltose/maltodextrin ABC transporter, permease protein 2 |
| glgP1 |
Gene: Athe_2576: Glycogen phosphorylase (EC 2.4.1.1) |
Gene: Csac_0429: Glycogen phosphorylase (EC 2.4.1.1) |
|
|
|
|
|
Glycogen phosphorylase (EC 2.4.1.1) |
| malR2 |
Gene: Athe_2575: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
Gene: Csac_0430: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
|
|
Gene: Teth514_0582: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
Gene: Thit_2246: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
Gene: TTE2576: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family |
| malE |
Gene: Athe_2574: Maltose/maltodextrin ABC transporter, substrate binding protein |
Gene: Csac_0431: Maltose/maltodextrin ABC transporter, substrate binding protein |
|
|
Gene: Teth514_1181: Maltose/maltodextrin ABC transporter, substrate binding protein |
Gene: Thit_1643: Maltose/maltodextrin ABC transporter, substrate binding protein |
Gene: TTE1831: Maltose/maltodextrin ABC transporter, substrate binding protein |
Maltose/maltodextrin ABC transporter, substrate binding protein |
| amyA |
|
|
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -230 score = 5.52034 sequence = ATGAGCAAAAGCTTGCAGAA Gene: Teth514_1180: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) |
*
Thermoanaerobacter italicus Ab9 Site: position = -228 score = 5.52034 sequence = ATGAGCAAAAGCTTGCAGAA Site: position = -106 score = 4.92662 sequence = AAGCGCAAGCGATTGCAAGA Gene: Thit_1644: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -229 score = 4.98304 sequence = ATGAGCAAAAGCTTGCAGAG Site: position = -107 score = 5.46392 sequence = TAGCGCAAGCGATTGCAATA Gene: TTE1832: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) |
Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) |
| CRON 4. | ||||||||
| amyB |
*
Anaerocellum thermophilum DSM 6725 Site: position = -91 score = 5.83288 sequence = TTATGCAAACATTTGCATTA Gene: Athe_2579: Neopullulanase (EC 3.2.1.135) |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -93 score = 5.83288 sequence = TTATGCAAACATTTGCATTA Gene: Csac_0426: Neopullulanase (EC 3.2.1.135) |
|
|
|
|
|
Neopullulanase (EC 3.2.1.135) |
| CRON 5. | ||||||||
| glgP2 |
|
|
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -74 score = 6.17914 sequence = TTGTGCAAACACTTGCATAA Gene: Teth514_1209: Glycogen phosphorylase (EC 2.4.1.1) |
*
Thermoanaerobacter italicus Ab9 Site: position = -74 score = 5.9384 sequence = TTGTGCAACCACTTGCATAA Gene: Thit_1602: Glycogen phosphorylase (EC 2.4.1.1) |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -76 score = 6.17914 sequence = TTGTGCAAACACTTGCATAA Gene: TTE1805: Glycogen phosphorylase (EC 2.4.1.1) |
Glycogen phosphorylase (EC 2.4.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |