Regulog MalR2 - Thermoanaerobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Statistics of regulated genes
Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725	6	2
Caldicellulosiruptor saccharolyticus DSM 8903	6	2
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514	6	3
Thermoanaerobacter italicus Ab9	6	3
Thermoanaerobacter tengcongensis MB4	6	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
TTE1813	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	* Thermoanaerobacter tengcongensis MB4 Site: position = -40 score = 5.24675 sequence = TATAACAAACGTTTGCACAA Gene: TTE1813: Glucoamylase (EC 3.2.1.3)	Glucoamylase (EC 3.2.1.3)

CRON 2.
glgB	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -96 score = 4.94036 sequence = TTATGAAAGCGATTGCCTAA Site: position = -154 score = 5.64174 sequence = TTGCGCAAAAATTTGCACAA Gene: Teth514_1781: Alpha amylase, catalytic region	* Thermoanaerobacter italicus Ab9 Site: position = -153 score = 5.01998 sequence = TTGCGCAAAAAATTGCACAG Site: position = -96 score = 5.47766 sequence = TTGTGAAAGCGATTGCTTAA Gene: Thit_0062: Alpha amylase, catalytic region	Thermoanaerobacter tengcongensis MB4	Alpha amylase, catalytic region

CRON 3.
malF	* Anaerocellum thermophilum DSM 6725 Site: position = -45 score = 5.84221 sequence = AAGAGCAAACGATTGCACAT Gene: Athe_2578: Maltose/maltodextrin ABC transporter, permease protein 1	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -46 score = 5.63904 sequence = AAGAGCAAACGATTGCACAC Gene: Csac_0427: Maltose/maltodextrin ABC transporter, permease protein 1	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1182: Maltose/maltodextrin ABC transporter, permease protein 1	Thermoanaerobacter italicus Ab9 Gene: Thit_1642: Maltose/maltodextrin ABC transporter, permease protein 1	Thermoanaerobacter tengcongensis MB4 Gene: TTE1830: Maltose/maltodextrin ABC transporter, permease protein 1	Maltose/maltodextrin ABC transporter, permease protein 1
malG	Anaerocellum thermophilum DSM 6725 Gene: Athe_2577: Maltose/maltodextrin ABC transporter, permease protein 2	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0428: Maltose/maltodextrin ABC transporter, permease protein 2	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1183: Maltose/maltodextrin ABC transporter, permease protein 2	Thermoanaerobacter italicus Ab9 Gene: Thit_1641: Maltose/maltodextrin ABC transporter, permease protein 2	Thermoanaerobacter tengcongensis MB4 Gene: TTE1829: Maltose/maltodextrin ABC transporter, permease protein 2	Maltose/maltodextrin ABC transporter, permease protein 2
glgP1	Anaerocellum thermophilum DSM 6725 Gene: Athe_2576: Glycogen phosphorylase (EC 2.4.1.1)	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0429: Glycogen phosphorylase (EC 2.4.1.1)	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Glycogen phosphorylase (EC 2.4.1.1)
malR2	Anaerocellum thermophilum DSM 6725 Gene: Athe_2575: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0430: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0582: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family	Thermoanaerobacter italicus Ab9 Gene: Thit_2246: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family	Thermoanaerobacter tengcongensis MB4 Gene: TTE2576: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family	Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
malE	Anaerocellum thermophilum DSM 6725 Gene: Athe_2574: Maltose/maltodextrin ABC transporter, substrate binding protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0431: Maltose/maltodextrin ABC transporter, substrate binding protein	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1181: Maltose/maltodextrin ABC transporter, substrate binding protein	Thermoanaerobacter italicus Ab9 Gene: Thit_1643: Maltose/maltodextrin ABC transporter, substrate binding protein	Thermoanaerobacter tengcongensis MB4 Gene: TTE1831: Maltose/maltodextrin ABC transporter, substrate binding protein	Maltose/maltodextrin ABC transporter, substrate binding protein
amyA	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -230 score = 5.52034 sequence = ATGAGCAAAAGCTTGCAGAA Gene: Teth514_1180: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)	* Thermoanaerobacter italicus Ab9 Site: position = -228 score = 5.52034 sequence = ATGAGCAAAAGCTTGCAGAA Site: position = -106 score = 4.92662 sequence = AAGCGCAAGCGATTGCAAGA Gene: Thit_1644: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)	* Thermoanaerobacter tengcongensis MB4 Site: position = -229 score = 4.98304 sequence = ATGAGCAAAAGCTTGCAGAG Site: position = -107 score = 5.46392 sequence = TAGCGCAAGCGATTGCAATA Gene: TTE1832: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)	Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)

CRON 4.
amyB	* Anaerocellum thermophilum DSM 6725 Site: position = -91 score = 5.83288 sequence = TTATGCAAACATTTGCATTA Gene: Athe_2579: Neopullulanase (EC 3.2.1.135)	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -93 score = 5.83288 sequence = TTATGCAAACATTTGCATTA Gene: Csac_0426: Neopullulanase (EC 3.2.1.135)	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Neopullulanase (EC 3.2.1.135)

CRON 5.
glgP2	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -74 score = 6.17914 sequence = TTGTGCAAACACTTGCATAA Gene: Teth514_1209: Glycogen phosphorylase (EC 2.4.1.1)	* Thermoanaerobacter italicus Ab9 Site: position = -74 score = 5.9384 sequence = TTGTGCAACCACTTGCATAA Gene: Thit_1602: Glycogen phosphorylase (EC 2.4.1.1)	* Thermoanaerobacter tengcongensis MB4 Site: position = -76 score = 6.17914 sequence = TTGTGCAAACACTTGCATAA Gene: TTE1805: Glycogen phosphorylase (EC 2.4.1.1)	Glycogen phosphorylase (EC 2.4.1.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MalR2 - Thermoanaerobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --