Regulon of MalR2 in Thermoanaerobacter italicus Ab9

Properties
Regulator type:	Transcription factor
TF locus tag:	Thit_2246
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 5 Sequence: TTGCGCAAAAAATTGCACAG Position: -96 Score: 5.5 Sequence: TTGTGAAAGCGATTGCTTAA Locus tag: Thit_0062 Name: glgB Funciton: Alpha amylase, catalytic region
	Thit_0062	glgB	Alpha amylase, catalytic region
Position: -74 Score: 5.9 Sequence: TTGTGCAACCACTTGCATAA Locus tag: Thit_1602 Name: glgP2 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
	Thit_1602	glgP2	Glycogen phosphorylase (EC 2.4.1.1)
Position: -228 Score: 5.5 Sequence: ATGAGCAAAAGCTTGCAGAA Position: -106 Score: 4.9 Sequence: AAGCGCAAGCGATTGCAAGA Locus tag: Thit_1644 Name: amyA Funciton: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) Locus tag: Thit_1643 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein Locus tag: Thit_1642 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Thit_1641 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	Thit_1644	amyA	Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
	Thit_1643	malE	Maltose/maltodextrin ABC transporter, substrate binding protein
	Thit_1642	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	Thit_1641	malG	Maltose/maltodextrin ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD