Regulon of MalR2 in Anaerocellum thermophilum DSM 6725

Properties
Regulator type:	Transcription factor
TF locus tag:	Athe_2575
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.8 Sequence: AAGAGCAAACGATTGCACAT Locus tag: Athe_2578 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Athe_2577 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: Athe_2576 Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1) Locus tag: Athe_2575 Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family Locus tag: Athe_2574 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
	Athe_2578	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	Athe_2577	malG	Maltose/maltodextrin ABC transporter, permease protein 2
	Athe_2576	glgP1	Glycogen phosphorylase (EC 2.4.1.1)
	Athe_2575	malR2	Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
	Athe_2574	malE	Maltose/maltodextrin ABC transporter, substrate binding protein
Position: -91 Score: 5.8 Sequence: TTATGCAAACATTTGCATTA Locus tag: Athe_2579 Name: amyB Funciton: Neopullulanase (EC 3.2.1.135)
	Athe_2579	amyB	Neopullulanase (EC 3.2.1.135)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD