Regulon of MalR2 in Thermoanaerobacter tengcongensis MB4

Properties
Regulator type:	Transcription factor
TF locus tag:	TTE2576
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.2 Sequence: TATAACAAACGTTTGCACAA Locus tag: TTE1813 Name: null Funciton: Glucoamylase (EC 3.2.1.3)
	TTE1813		Glucoamylase (EC 3.2.1.3)
Position: -229 Score: 5 Sequence: ATGAGCAAAAGCTTGCAGAG Position: -107 Score: 5.5 Sequence: TAGCGCAAGCGATTGCAATA Locus tag: TTE1832 Name: amyA Funciton: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133) Locus tag: TTE1831 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein Locus tag: TTE1830 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: TTE1829 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	TTE1832	amyA	Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
	TTE1831	malE	Maltose/maltodextrin ABC transporter, substrate binding protein
	TTE1830	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	TTE1829	malG	Maltose/maltodextrin ABC transporter, permease protein 2
Position: -76 Score: 6.2 Sequence: TTGTGCAAACACTTGCATAA Locus tag: TTE1805 Name: glgP2 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
	TTE1805	glgP2	Glycogen phosphorylase (EC 2.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD