Regulog BglR - Listeriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Listeria welshimeri serovar 6b str. SLCC5334	6	2
Listeria seeligeri serovar 1/2b str. SLCC3954	6	2
Listeria monocytogenes EGD-e	6	2
Listeria innocua Clip11262	6	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
bglX	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -290 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lwe1746: Beta-glucosidase (EC 3.2.1.21)	* Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -289 score = 6.52852 sequence = CTATAGAAACGTTTCGACAA Gene: lse_1700: Beta-glucosidase (EC 3.2.1.21)	* Listeria monocytogenes EGD-e Site: position = -289 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lmo1729: Beta-glucosidase (EC 3.2.1.21)	* Listeria innocua Clip11262 Site: position = -290 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lin1840: Beta-glucosidase (EC 3.2.1.21)	Beta-glucosidase (EC 3.2.1.21)
cbpA	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe1745: Cellobiose phosphorylase (EC 2.4.1.-)	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_1699: Cellobiose phosphorylase (EC 2.4.1.-)	Listeria monocytogenes EGD-e Gene: lmo1728: Cellobiose phosphorylase (EC 2.4.1.-)	Listeria innocua Clip11262 Gene: lin1839: Cellobiose phosphorylase (EC 2.4.1.-)	Cellobiose phosphorylase (EC 2.4.1.-)
bglR	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe1744: Transcriptional regulator for beta-glucoside utilization, LacI family	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_1698: Transcriptional regulator for beta-glucoside utilization, LacI family	Listeria monocytogenes EGD-e Gene: lmo1727: Transcriptional regulator for beta-glucoside utilization, LacI family	Listeria innocua Clip11262 Gene: lin1838: Transcriptional regulator for beta-glucoside utilization, LacI family	Transcriptional regulator for beta-glucoside utilization, LacI family

CRON 2.
bglA	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -160 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lwe1747: Predicted beta-glucoside ABC transport system, sugar-binding protein	* Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -160 score = 6.52852 sequence = TTGTCGAAACGTTTCTATAG Gene: lse_1701: Predicted beta-glucoside ABC transport system, sugar-binding protein	* Listeria monocytogenes EGD-e Site: position = -158 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lmo1730: Predicted beta-glucoside ABC transport system, sugar-binding protein	* Listeria innocua Clip11262 Site: position = -158 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lin1841: Predicted beta-glucoside ABC transport system, sugar-binding protein	Predicted beta-glucoside ABC transport system, sugar-binding protein
bglB	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe1748: Predicted beta-glucoside ABC transport system, permease protein 1	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_1702: Predicted beta-glucoside ABC transport system, permease protein 1	Listeria monocytogenes EGD-e Gene: lmo1731: Predicted beta-glucoside ABC transport system, permease protein 1	Listeria innocua Clip11262 Gene: lin1842: Predicted beta-glucoside ABC transport system, permease protein 1	Predicted beta-glucoside ABC transport system, permease protein 1
bglC	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe1749: Predicted beta-glucoside ABC transport system, permease protein 2	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_1703: Predicted beta-glucoside ABC transport system, permease protein 2	Listeria monocytogenes EGD-e Gene: lmo1732: Predicted beta-glucoside ABC transport system, permease protein 2	Listeria innocua Clip11262 Gene: lin1843: Predicted beta-glucoside ABC transport system, permease protein 2	Predicted beta-glucoside ABC transport system, permease protein 2

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BglR - Listeriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --