Regulog BglR - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria welshimeri serovar 6b str. SLCC5334 | 6 | 2 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 6 | 2 |
| Listeria monocytogenes EGD-e | 6 | 2 |
| Listeria innocua Clip11262 | 6 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| bglX |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -290 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lwe1746: Beta-glucosidase (EC 3.2.1.21) |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -289 score = 6.52852 sequence = CTATAGAAACGTTTCGACAA Gene: lse_1700: Beta-glucosidase (EC 3.2.1.21) |
*
Listeria monocytogenes EGD-e Site: position = -289 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lmo1729: Beta-glucosidase (EC 3.2.1.21) |
*
Listeria innocua Clip11262 Site: position = -290 score = 6.74215 sequence = TCATAGAAACGTTTCGACAA Gene: lin1840: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| cbpA |
Gene: lwe1745: Cellobiose phosphorylase (EC 2.4.1.-) |
Gene: lse_1699: Cellobiose phosphorylase (EC 2.4.1.-) |
Gene: lmo1728: Cellobiose phosphorylase (EC 2.4.1.-) |
Gene: lin1839: Cellobiose phosphorylase (EC 2.4.1.-) |
Cellobiose phosphorylase (EC 2.4.1.-) |
| bglR |
Gene: lwe1744: Transcriptional regulator for beta-glucoside utilization, LacI family |
Gene: lse_1698: Transcriptional regulator for beta-glucoside utilization, LacI family |
Gene: lmo1727: Transcriptional regulator for beta-glucoside utilization, LacI family |
Gene: lin1838: Transcriptional regulator for beta-glucoside utilization, LacI family |
Transcriptional regulator for beta-glucoside utilization, LacI family |
| CRON 2. | |||||
| bglA |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -160 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lwe1747: Predicted beta-glucoside ABC transport system, sugar-binding protein |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -160 score = 6.52852 sequence = TTGTCGAAACGTTTCTATAG Gene: lse_1701: Predicted beta-glucoside ABC transport system, sugar-binding protein |
*
Listeria monocytogenes EGD-e Site: position = -158 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lmo1730: Predicted beta-glucoside ABC transport system, sugar-binding protein |
*
Listeria innocua Clip11262 Site: position = -158 score = 6.74215 sequence = TTGTCGAAACGTTTCTATGA Gene: lin1841: Predicted beta-glucoside ABC transport system, sugar-binding protein |
Predicted beta-glucoside ABC transport system, sugar-binding protein |
| bglB |
Gene: lwe1748: Predicted beta-glucoside ABC transport system, permease protein 1 |
Gene: lse_1702: Predicted beta-glucoside ABC transport system, permease protein 1 |
Gene: lmo1731: Predicted beta-glucoside ABC transport system, permease protein 1 |
Gene: lin1842: Predicted beta-glucoside ABC transport system, permease protein 1 |
Predicted beta-glucoside ABC transport system, permease protein 1 |
| bglC |
Gene: lwe1749: Predicted beta-glucoside ABC transport system, permease protein 2 |
Gene: lse_1703: Predicted beta-glucoside ABC transport system, permease protein 2 |
Gene: lmo1732: Predicted beta-glucoside ABC transport system, permease protein 2 |
Gene: lin1843: Predicted beta-glucoside ABC transport system, permease protein 2 |
Predicted beta-glucoside ABC transport system, permease protein 2 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |