Regulon of BglR in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo1727
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -289 Score: 6.7 Sequence: TCATAGAAACGTTTCGACAA Locus tag: lmo1729 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: lmo1728 Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-) Locus tag: lmo1727 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
	lmo1729	bglX	Beta-glucosidase (EC 3.2.1.21)
	lmo1728	cbpA	Cellobiose phosphorylase (EC 2.4.1.-)
	lmo1727	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
Position: -158 Score: 6.7 Sequence: TTGTCGAAACGTTTCTATGA Locus tag: lmo1730 Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein Locus tag: lmo1731 Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1 Locus tag: lmo1732 Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
	lmo1730	bglA	Predicted beta-glucoside ABC transport system, sugar-binding protein
	lmo1731	bglB	Predicted beta-glucoside ABC transport system, permease protein 1
	lmo1732	bglC	Predicted beta-glucoside ABC transport system, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD