Regulon of BglR in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_1698
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -289 Score: 6.5 Sequence: CTATAGAAACGTTTCGACAA Locus tag: lse_1700 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: lse_1699 Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-) Locus tag: lse_1698 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
	lse_1700	bglX	Beta-glucosidase (EC 3.2.1.21)
	lse_1699	cbpA	Cellobiose phosphorylase (EC 2.4.1.-)
	lse_1698	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
Position: -160 Score: 6.5 Sequence: TTGTCGAAACGTTTCTATAG Locus tag: lse_1701 Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein Locus tag: lse_1702 Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1 Locus tag: lse_1703 Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
	lse_1701	bglA	Predicted beta-glucoside ABC transport system, sugar-binding protein
	lse_1702	bglB	Predicted beta-glucoside ABC transport system, permease protein 1
	lse_1703	bglC	Predicted beta-glucoside ABC transport system, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD