Regulon of BglR in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe1744
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -290 Score: 6.7 Sequence: TCATAGAAACGTTTCGACAA Locus tag: lwe1746 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: lwe1745 Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-) Locus tag: lwe1744 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
	lwe1746	bglX	Beta-glucosidase (EC 3.2.1.21)
	lwe1745	cbpA	Cellobiose phosphorylase (EC 2.4.1.-)
	lwe1744	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
Position: -160 Score: 6.7 Sequence: TTGTCGAAACGTTTCTATGA Locus tag: lwe1747 Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein Locus tag: lwe1748 Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1 Locus tag: lwe1749 Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
	lwe1747	bglA	Predicted beta-glucoside ABC transport system, sugar-binding protein
	lwe1748	bglB	Predicted beta-glucoside ABC transport system, permease protein 1
	lwe1749	bglC	Predicted beta-glucoside ABC transport system, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD