Regulon of BglR in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin1838
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -290 Score: 6.7 Sequence: TCATAGAAACGTTTCGACAA Locus tag: lin1840 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: lin1839 Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-) Locus tag: lin1838 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
	lin1840	bglX	Beta-glucosidase (EC 3.2.1.21)
	lin1839	cbpA	Cellobiose phosphorylase (EC 2.4.1.-)
	lin1838	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
Position: -158 Score: 6.7 Sequence: TTGTCGAAACGTTTCTATGA Locus tag: lin1841 Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein Locus tag: lin1842 Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1 Locus tag: lin1843 Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
	lin1841	bglA	Predicted beta-glucoside ABC transport system, sugar-binding protein
	lin1842	bglB	Predicted beta-glucoside ABC transport system, permease protein 1
	lin1843	bglC	Predicted beta-glucoside ABC transport system, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD