Regulog BglR2 - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside; Glucose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By TF family - LacI
- By effector - Beta-glucoside
- By effector - Glucose
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 8 | 3 |
| Caulobacter segnis ATCC 21756 | 8 | 3 |
| Caulobacter sp. K31 | 6 | 3 |
| Phenylobacterium zucineum HLK1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| glcT |
*
Caulobacter crescentus CB15 Site: position = -124 score = 5.81535 sequence = GGTTGACAACGTTGTCACGT Gene: CC1103: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Caulobacter segnis ATCC 21756 Site: position = -123 score = 5.83661 sequence = GGTTGACAACGTTGTCACGC Gene: Cseg_1232: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Caulobacter sp. K31 Site: position = -69 score = 5.54734 sequence = GCTTGACAACGTTGTCACCG Gene: Caul_1420: Predicted glucose transporter in beta-glucoside utilization gene cluster |
|
Predicted glucose transporter in beta-glucoside utilization gene cluster |
| CC1104 |
Gene: CC1104: sodium:dicarboxylate symporter family protein |
Gene: Cseg_1233: sodium:dicarboxylate symporter family protein |
|
|
sodium:dicarboxylate symporter family protein |
| bglX3 |
Gene: CC1105: Beta-glucosidase (EC 3.2.1.21) |
Gene: Cseg_1234: Beta-glucosidase (EC 3.2.1.21) |
Gene: Caul_3972: Beta-glucosidase (EC 3.2.1.21) |
|
Beta-glucosidase (EC 3.2.1.21) |
| CRON 2. | |||||
| bglR2 |
*
Caulobacter crescentus CB15 Site: position = -421 score = 6.40853 sequence = GAATGTCAACGTTGTCATTT Gene: CC0969: Transcriptional regulator of beta-glucoside utilization, LacI family |
*
Caulobacter segnis ATCC 21756 Site: position = -409 score = 6.14052 sequence = GAATGTCAACGTTGTCATTG Gene: Cseg_3735: Transcriptional regulator of beta-glucoside utilization, LacI family |
*
Caulobacter sp. K31 Site: position = -419 score = 6.38727 sequence = AAATGTCAACGTTGTCATTT Site: position = -105 score = 5.90941 sequence = GCATGACATCGTTGTCGTCC Gene: Caul_2141: Transcriptional regulator of beta-glucoside utilization, LacI family |
|
Transcriptional regulator of beta-glucoside utilization, LacI family |
| bglX2 |
Gene: CC0968: Beta-glucosidase (EC 3.2.1.21) |
Gene: Cseg_3736: Beta-glucosidase (EC 3.2.1.21) |
Gene: Caul_2140: Beta-glucosidase (EC 3.2.1.21) |
|
Beta-glucosidase (EC 3.2.1.21) |
| CRON 3. | |||||
| omp(Bgl)2 |
*
Caulobacter crescentus CB15 Site: position = -273 score = 6.40853 sequence = AAATGACAACGTTGACATTC Gene: CC0970: TonB-dependent uoter membrane transporter for beta-glucosides |
*
Caulobacter segnis ATCC 21756 Site: position = -270 score = 6.14052 sequence = CAATGACAACGTTGACATTC Gene: Cseg_3734: TonB-dependent uoter membrane transporter for beta-glucosides |
*
Caulobacter sp. K31 Site: position = -242 score = 6.38727 sequence = AAATGACAACGTTGACATTT Gene: Caul_2142: TonB-dependent uoter membrane transporter for beta-glucosides |
|
TonB-dependent uoter membrane transporter for beta-glucosides |
| thl2 |
Gene: CC0971: tryptophan halogenase, putative |
Gene: Cseg_3733: tryptophan halogenase, putative |
Gene: Caul_2143: tryptophan halogenase, putative |
|
tryptophan halogenase, putative |
| thl3 |
Gene: CC0972: tryptophan halogenase, putative |
Gene: Cseg_3732: tryptophan halogenase, putative |
Gene: Caul_2144: tryptophan halogenase, putative |
|
tryptophan halogenase, putative |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |