Statistics of regulated genes

Genome	Genes	Operons
Caulobacter crescentus CB15	8	3
Caulobacter segnis ATCC 21756	8	3
Caulobacter sp. K31	6	3
Phenylobacterium zucineum HLK1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
glcT	* Caulobacter crescentus CB15 Site: position = -124 score = 5.81535 sequence = GGTTGACAACGTTGTCACGT Gene: CC1103: Predicted glucose transporter in beta-glucoside utilization gene cluster	* Caulobacter segnis ATCC 21756 Site: position = -123 score = 5.83661 sequence = GGTTGACAACGTTGTCACGC Gene: Cseg_1232: Predicted glucose transporter in beta-glucoside utilization gene cluster	* Caulobacter sp. K31 Site: position = -69 score = 5.54734 sequence = GCTTGACAACGTTGTCACCG Gene: Caul_1420: Predicted glucose transporter in beta-glucoside utilization gene cluster	Phenylobacterium zucineum HLK1	Predicted glucose transporter in beta-glucoside utilization gene cluster
CC1104	Caulobacter crescentus CB15 Gene: CC1104: sodium:dicarboxylate symporter family protein	Caulobacter segnis ATCC 21756 Gene: Cseg_1233: sodium:dicarboxylate symporter family protein	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	sodium:dicarboxylate symporter family protein
bglX3	Caulobacter crescentus CB15 Gene: CC1105: Beta-glucosidase (EC 3.2.1.21)	Caulobacter segnis ATCC 21756 Gene: Cseg_1234: Beta-glucosidase (EC 3.2.1.21)	Caulobacter sp. K31 Gene: Caul_3972: Beta-glucosidase (EC 3.2.1.21)	Phenylobacterium zucineum HLK1	Beta-glucosidase (EC 3.2.1.21)
CRON 2.
bglR2	* Caulobacter crescentus CB15 Site: position = -421 score = 6.40853 sequence = GAATGTCAACGTTGTCATTT Gene: CC0969: Transcriptional regulator of beta-glucoside utilization, LacI family	* Caulobacter segnis ATCC 21756 Site: position = -409 score = 6.14052 sequence = GAATGTCAACGTTGTCATTG Gene: Cseg_3735: Transcriptional regulator of beta-glucoside utilization, LacI family	* Caulobacter sp. K31 Site: position = -419 score = 6.38727 sequence = AAATGTCAACGTTGTCATTT Site: position = -105 score = 5.90941 sequence = GCATGACATCGTTGTCGTCC Gene: Caul_2141: Transcriptional regulator of beta-glucoside utilization, LacI family	Phenylobacterium zucineum HLK1	Transcriptional regulator of beta-glucoside utilization, LacI family
bglX2	Caulobacter crescentus CB15 Gene: CC0968: Beta-glucosidase (EC 3.2.1.21)	Caulobacter segnis ATCC 21756 Gene: Cseg_3736: Beta-glucosidase (EC 3.2.1.21)	Caulobacter sp. K31 Gene: Caul_2140: Beta-glucosidase (EC 3.2.1.21)	Phenylobacterium zucineum HLK1	Beta-glucosidase (EC 3.2.1.21)
CRON 3.
omp(Bgl)2	* Caulobacter crescentus CB15 Site: position = -273 score = 6.40853 sequence = AAATGACAACGTTGACATTC Gene: CC0970: TonB-dependent uoter membrane transporter for beta-glucosides	* Caulobacter segnis ATCC 21756 Site: position = -270 score = 6.14052 sequence = CAATGACAACGTTGACATTC Gene: Cseg_3734: TonB-dependent uoter membrane transporter for beta-glucosides	* Caulobacter sp. K31 Site: position = -242 score = 6.38727 sequence = AAATGACAACGTTGACATTT Gene: Caul_2142: TonB-dependent uoter membrane transporter for beta-glucosides	Phenylobacterium zucineum HLK1	TonB-dependent uoter membrane transporter for beta-glucosides
thl2	Caulobacter crescentus CB15 Gene: CC0971: tryptophan halogenase, putative	Caulobacter segnis ATCC 21756 Gene: Cseg_3733: tryptophan halogenase, putative	Caulobacter sp. K31 Gene: Caul_2143: tryptophan halogenase, putative	Phenylobacterium zucineum HLK1	tryptophan halogenase, putative
thl3	Caulobacter crescentus CB15 Gene: CC0972: tryptophan halogenase, putative	Caulobacter segnis ATCC 21756 Gene: Cseg_3732: tryptophan halogenase, putative	Caulobacter sp. K31 Gene: Caul_2144: tryptophan halogenase, putative	Phenylobacterium zucineum HLK1	tryptophan halogenase, putative

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD