Regulon of BglR2 in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2141
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR2 - Caulobacterales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -242 Score: 6.4 Sequence: AAATGACAACGTTGACATTT Locus tag: Caul_2142 Name: omp(Bgl)2 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: Caul_2143 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Caul_2144 Name: thl3 Funciton: tryptophan halogenase, putative
	Caul_2142	omp(Bgl)2	TonB-dependent uoter membrane transporter for beta-glucosides
	Caul_2143	thl2	tryptophan halogenase, putative
	Caul_2144	thl3	tryptophan halogenase, putative
Position: -419 Score: 6.4 Sequence: AAATGTCAACGTTGTCATTT Position: -105 Score: 5.9 Sequence: GCATGACATCGTTGTCGTCC Locus tag: Caul_2141 Name: bglR2 Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: Caul_2140 Name: bglX2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	Caul_2141	bglR2	Transcriptional regulator of beta-glucoside utilization, LacI family
	Caul_2140	bglX2	Beta-glucosidase (EC 3.2.1.21)
Position: -69 Score: 5.5 Sequence: GCTTGACAACGTTGTCACCG Locus tag: Caul_1420 Name: glcT Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster
	Caul_1420	glcT	Predicted glucose transporter in beta-glucoside utilization gene cluster

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD