Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing thl2 gene

Properties
Regulog: BglR2 - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -273
Score: 6.40853
Sequence: AAATGACAACGTTGACATTC
Locus tag: CC0970
Name: omp(Bgl)2
Funciton: TonB-dependent uoter membrane transporter for beta-glucosides
Locus tag: CC0971
Name: thl2
Funciton: tryptophan halogenase, putative
Locus tag: CC0972
Name: thl3
Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3 -273 6.4 AAATGACAACGTTGACATTC CC0970
Caulobacter segnis ATCC 21756
Position: -270
Score: 6.14052
Sequence: CAATGACAACGTTGACATTC
Locus tag: Cseg_3734
Name: omp(Bgl)2
Funciton: TonB-dependent uoter membrane transporter for beta-glucosides
Locus tag: Cseg_3733
Name: thl2
Funciton: tryptophan halogenase, putative
Locus tag: Cseg_3732
Name: thl3
Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3 -270 6.1 CAATGACAACGTTGACATTC Cseg_3734
Caulobacter sp. K31
Position: -242
Score: 6.38727
Sequence: AAATGACAACGTTGACATTT
Locus tag: Caul_2142
Name: omp(Bgl)2
Funciton: TonB-dependent uoter membrane transporter for beta-glucosides
Locus tag: Caul_2143
Name: thl2
Funciton: tryptophan halogenase, putative
Locus tag: Caul_2144
Name: thl3
Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3 -242 6.4 AAATGACAACGTTGACATTT Caul_2142