Regulon of BglR2 in Caulobacter crescentus CB15

Properties
Regulator type:	Transcription factor
TF locus tag:	CC0969
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR2 - Caulobacterales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -273 Score: 6.4 Sequence: AAATGACAACGTTGACATTC Locus tag: CC0970 Name: omp(Bgl)2 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: CC0971 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: CC0972 Name: thl3 Funciton: tryptophan halogenase, putative
	CC0970	omp(Bgl)2	TonB-dependent uoter membrane transporter for beta-glucosides
	CC0971	thl2	tryptophan halogenase, putative
	CC0972	thl3	tryptophan halogenase, putative
Position: -421 Score: 6.4 Sequence: GAATGTCAACGTTGTCATTT Locus tag: CC0969 Name: bglR2 Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: CC0968 Name: bglX2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	CC0969	bglR2	Transcriptional regulator of beta-glucoside utilization, LacI family
	CC0968	bglX2	Beta-glucosidase (EC 3.2.1.21)
Position: -124 Score: 5.8 Sequence: GGTTGACAACGTTGTCACGT Locus tag: CC1103 Name: glcT Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster Locus tag: CC1104 Name: null Funciton: sodium:dicarboxylate symporter family protein Locus tag: CC1105 Name: bglX3 Funciton: Beta-glucosidase (EC 3.2.1.21)
	CC1103	glcT	Predicted glucose transporter in beta-glucoside utilization gene cluster
	CC1104		sodium:dicarboxylate symporter family protein
	CC1105	bglX3	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD