Regulog BglR1 - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	4	1
Caulobacter segnis ATCC 21756
Caulobacter sp. K31	2	1
Phenylobacterium zucineum HLK1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
omp(Bgl)1	* Caulobacter crescentus CB15 Site: position = -98 score = 6.66168 sequence = AATTGGAAGCGCTTCCATAG Gene: CC1754: TonB-dependent uoter membrane transporter for beta-glucosides	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -108 score = 6.85606 sequence = TGTTGGAAGCGCTTCCAATG Gene: Caul_2063: TonB-dependent uoter membrane transporter for beta-glucosides	Phenylobacterium zucineum HLK1	TonB-dependent uoter membrane transporter for beta-glucosides
thl1	Caulobacter crescentus CB15 Gene: CC1755: Tryptophan halogenase	Caulobacter segnis ATCC 21756	Caulobacter sp. K31 Gene: Caul_2064: Tryptophan halogenase	Phenylobacterium zucineum HLK1	Tryptophan halogenase
bglX1	Caulobacter crescentus CB15 Gene: CC1756: Beta-glucosidase (EC 3.2.1.21)	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	Beta-glucosidase (EC 3.2.1.21)
GH30	Caulobacter crescentus CB15 Gene: CC1757: Glycosyl hydrolase, family 30	Caulobacter segnis ATCC 21756	Caulobacter sp. K31 Gene: Caul_2067: Glycosyl hydrolase, family 30	Phenylobacterium zucineum HLK1	Glycosyl hydrolase, family 30

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --