Regulon of BglR1 in Caulobacter crescentus CB15

Properties
Regulator type:	Transcription factor
TF locus tag:	CC1753
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR1 - Caulobacterales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 6.7 Sequence: AATTGGAAGCGCTTCCATAG Locus tag: CC1754 Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: CC1755 Name: thl1 Funciton: Tryptophan halogenase Locus tag: CC1756 Name: bglX1 Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: CC1757 Name: GH30 Funciton: Glycosyl hydrolase, family 30
	CC1754	omp(Bgl)1	TonB-dependent uoter membrane transporter for beta-glucosides
	CC1755	thl1	Tryptophan halogenase
	CC1756	bglX1	Beta-glucosidase (EC 3.2.1.21)
	CC1757	GH30	Glycosyl hydrolase, family 30

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD