Profile of regulator BglR1 in Caulobacterales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR1 - Caulobacterales

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Caulobacter crescentus CB15
	CC1754	omp(Bgl)1	-98	6.7	AATTGGAAGCGCTTCCATAG
Caulobacter sp. K31
	Caul_2063	omp(Bgl)1	-108	6.9	TGTTGGAAGCGCTTCCAATG

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD