Regulon of BglR1 in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2062
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR1 - Caulobacterales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 6.9 Sequence: TGTTGGAAGCGCTTCCAATG Locus tag: Caul_2063 Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: Caul_2064 Name: thl1 Funciton: Tryptophan halogenase
	Caul_2063	omp(Bgl)1	TonB-dependent uoter membrane transporter for beta-glucosides
	Caul_2064	thl1	Tryptophan halogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD