Regulog AduR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Adenosine utilization |
| Effector: | Adenosine |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Adenosine
- By pathway - Adenosine utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 7 | 1 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 7 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | 7 | 1 |
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 4 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| aduR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -36 score = 7.20731 sequence = CTGATTAAACGTTTAATCAG Gene: Atu4420: Predicted transcriptional regulator for adenosine utilization, LacI family |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -32 score = 7.15467 sequence = CTGATTAAACGATTAATCAG Gene: RHE_CH03414: Predicted transcriptional regulator for adenosine utilization, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -34 score = 6.84229 sequence = CTGATTAAACGATTAATCAA Gene: RL3877: Predicted transcriptional regulator for adenosine utilization, LacI family |
|
|
*
Sinorhizobium meliloti 1021 Site: position = -43 score = 6.34022 sequence = CAGCTTAATCGTTTAATCAT Gene: SMb21272: Predicted transcriptional regulator for adenosine utilization, LacI family |
|
Predicted transcriptional regulator for adenosine utilization, LacI family |
| aduA |
Gene: Atu4421: Predicted adenosine ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_CH03415: Predicted adenosine ABC transporter, substrate-binding protein |
Gene: RL3878: Predicted adenosine ABC transporter, substrate-binding protein |
|
|
Gene: SMb21273: Predicted adenosine ABC transporter, substrate-binding protein |
|
Predicted adenosine ABC transporter, substrate-binding protein |
| aduB |
Gene: Atu4422: Predicted adenosine ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
Gene: RHE_CH03416: Predicted adenosine ABC transporter, permease component 1 |
Gene: RL3879: Predicted adenosine ABC transporter, permease component 1 |
|
|
Gene: SMb21274: Predicted adenosine ABC transporter, permease component 1 |
|
Predicted adenosine ABC transporter, permease component 1 |
| aduC |
Gene: Atu4423: Predicted adenosine ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
Gene: RHE_CH03417: Predicted adenosine ABC transporter, permease component 2 |
Gene: RL3880: Predicted adenosine ABC transporter, permease component 2 |
|
|
Gene: SMb21275: Predicted adenosine ABC transporter, permease component 2 |
|
Predicted adenosine ABC transporter, permease component 2 |
| aduD |
Gene: Atu4424: Predicted adenosine ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_CH03418: Predicted adenosine ABC transporter, ATP-binding protein |
Gene: RL3881: Predicted adenosine ABC transporter, ATP-binding protein |
|
|
|
|
Predicted adenosine ABC transporter, ATP-binding protein |
| aduH |
Gene: Atu4425: putative Adenosine hydrolase (EC 3.2.2.1) |
|
|
|
|
|
|
|
|
Gene: RHE_CH03419: putative Adenosine hydrolase (EC 3.2.2.1) |
Gene: RL3882: putative Adenosine hydrolase (EC 3.2.2.1) |
|
|
Gene: SMb21277: putative Adenosine hydrolase (EC 3.2.2.1) |
|
putative Adenosine hydrolase (EC 3.2.2.1) |
| ade |
Gene: Atu4426: Adenine deaminase (EC 3.5.4.2) |
|
|
|
|
|
|
|
|
Gene: RHE_CH03420: Adenine deaminase (EC 3.5.4.2) |
Gene: RL3883: Adenine deaminase (EC 3.5.4.2) |
|
|
Gene: SMb21278: Adenine deaminase (EC 3.5.4.2) |
|
Adenine deaminase (EC 3.5.4.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |