Regulon of AduR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb21272
Regulator family:	LacI
Regulation mode:
Biological process:	Adenosine utilization
Effector:	Adenosine
Regulog:	AduR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Adenosine
By pathway - Adenosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.3 Sequence: CAGCTTAATCGTTTAATCAT Locus tag: SMb21272 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: SMb21273 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: SMb21274 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: SMb21275 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2
	SMb21272	aduR	Predicted transcriptional regulator for adenosine utilization, LacI family
	SMb21273	aduA	Predicted adenosine ABC transporter, substrate-binding protein
	SMb21274	aduB	Predicted adenosine ABC transporter, permease component 1
	SMb21275	aduC	Predicted adenosine ABC transporter, permease component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD