Regulon of AduR in Sinorhizobium meliloti 1021
| Regulator type: | Transcription factor |
| TF locus tag: | SMb21272 |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Adenosine utilization |
| Effector: | Adenosine |
| Regulog: | AduR - Rhizobiales |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Adenosine
- By pathway - Adenosine utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -43
Score: 6.3 Sequence: CAGCTTAATCGTTTAATCAT
Locus tag: SMb21272
Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: SMb21273
Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: SMb21274
Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: SMb21275
Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2 |
|||
|
aduR
|
Predicted transcriptional regulator for adenosine utilization, LacI family
|
||
|
aduA
|
Predicted adenosine ABC transporter, substrate-binding protein
|
||
|
aduB
|
Predicted adenosine ABC transporter, permease component 1
|
||
|
aduC
|
Predicted adenosine ABC transporter, permease component 2
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |