Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing aduH gene

Properties
Regulog: AduR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Adenosine utilization
Effector: Adenosine
Phylum: Proteobacteria/Alpha
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -36
Score: 7.20731
Sequence: CTGATTAAACGTTTAATCAG
Locus tag: Atu4420
Name: aduR
Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: Atu4421
Name: aduA
Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: Atu4422
Name: aduB
Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: Atu4423
Name: aduC
Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: Atu4424
Name: aduD
Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: Atu4425
Name: aduH
Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: Atu4426
Name: ade
Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade -36 7.2 CTGATTAAACGTTTAATCAG Atu4420
Rhizobium etli CFN 42
Position: -32
Score: 7.15467
Sequence: CTGATTAAACGATTAATCAG
Locus tag: RHE_CH03414
Name: aduR
Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: RHE_CH03415
Name: aduA
Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: RHE_CH03416
Name: aduB
Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: RHE_CH03417
Name: aduC
Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: RHE_CH03418
Name: aduD
Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: RHE_CH03419
Name: aduH
Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: RHE_CH03420
Name: ade
Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade -32 7.2 CTGATTAAACGATTAATCAG RHE_CH03414
Rhizobium leguminosarum bv. viciae 3841
Position: -34
Score: 6.84229
Sequence: CTGATTAAACGATTAATCAA
Locus tag: RL3877
Name: aduR
Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: RL3878
Name: aduA
Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: RL3879
Name: aduB
Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: RL3880
Name: aduC
Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: RL3881
Name: aduD
Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: RL3882
Name: aduH
Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: RL3883
Name: ade
Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade -34 6.8 CTGATTAAACGATTAATCAA RL3877