Regulon of AduR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH03414
Regulator family:	LacI
Regulation mode:
Biological process:	Adenosine utilization
Effector:	Adenosine
Regulog:	AduR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Adenosine
By pathway - Adenosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 7.2 Sequence: CTGATTAAACGATTAATCAG Locus tag: RHE_CH03414 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: RHE_CH03415 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: RHE_CH03416 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: RHE_CH03417 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2 Locus tag: RHE_CH03418 Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein Locus tag: RHE_CH03419 Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1) Locus tag: RHE_CH03420 Name: ade Funciton: Adenine deaminase (EC 3.5.4.2)
	RHE_CH03414	aduR	Predicted transcriptional regulator for adenosine utilization, LacI family
	RHE_CH03415	aduA	Predicted adenosine ABC transporter, substrate-binding protein
	RHE_CH03416	aduB	Predicted adenosine ABC transporter, permease component 1
	RHE_CH03417	aduC	Predicted adenosine ABC transporter, permease component 2
	RHE_CH03418	aduD	Predicted adenosine ABC transporter, ATP-binding protein
	RHE_CH03419	aduH	putative Adenosine hydrolase (EC 3.2.2.1)
	RHE_CH03420	ade	Adenine deaminase (EC 3.5.4.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD