Regulog MerR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | ||
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | 5 | 1 |
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | 3 | 1 |
| Chromobacterium violaceum ATCC 12472 | ||
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| merT |
|
|
|
*
Nitrosomonas europaea ATCC 19718 Site: position = -63 score = 6.1447 sequence = ACTCCGTACATGACTACGGAAG Gene: NE0842: Mercury uptake inner membane protein |
|
*
Thiobacillus denitrificans Site: position = -52 score = 6.20954 sequence = ACTCCGTACATAACTACGGAAA Gene: Tbd_1339: Mercury uptake inner membane protein |
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP |
|
|
|
Gene: NE0841: Periplasmic mercury (+2) binding protein |
|
Gene: Tbd_1340: Periplasmic mercury (+2) binding protein |
|
|
|
|
|
|
Periplasmic mercury (+2) binding protein |
| merC |
|
|
|
Gene: NE0840: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merA |
|
|
|
Gene: NE0839: Mercuric ion reductase (EC 1.16.1.1) |
|
Gene: Tbd_1341: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD |
|
|
|
Gene: NE0838: Mercuric resistance operon coregulator |
|
|
|
|
|
|
|
|
Mercuric resistance operon coregulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |