Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merC gene

Properties
Regulog: MerR - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nitrosomonas europaea ATCC 19718
Position: -63
Score: 6.1447
Sequence: ACTCCGTACATGACTACGGAAG
Locus tag: NE0842
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: NE0841
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: NE0840
Name: merC
Funciton: Mercury uptake inner membane protein
Locus tag: NE0839
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: NE0838
Name: merD
Funciton: Mercuric resistance operon coregulator
merT-merP-merC-merA-merD -63 6.1 ACTCCGTACATGACTACGGAAG NE0842