Regulon of MerR in Thiobacillus denitrificans

Properties
Regulator type:	Transcription factor
TF locus tag:	Tbd_1338
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.2 Sequence: ACTCCGTACATAACTACGGAAA Locus tag: Tbd_1339 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Tbd_1340 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Tbd_1341 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
	Tbd_1339	merT	Mercury uptake inner membane protein
	Tbd_1340	merP	Periplasmic mercury (+2) binding protein
	Tbd_1341	merA	Mercuric ion reductase (EC 1.16.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD