Regulon of MerR in Nitrosomonas europaea ATCC 19718

Properties
Regulator type:	Transcription factor
TF locus tag:	NE0843
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.1 Sequence: ACTCCGTACATGACTACGGAAG Locus tag: NE0842 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: NE0841 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: NE0840 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: NE0839 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: NE0838 Name: merD Funciton: Mercuric resistance operon coregulator
	NE0842	merT	Mercury uptake inner membane protein
	NE0841	merP	Periplasmic mercury (+2) binding protein
	NE0840	merC	Mercury uptake inner membane protein
	NE0839	merA	Mercuric ion reductase (EC 1.16.1.1)
	NE0838	merD	Mercuric resistance operon coregulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD