Regulog MerR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei	12	3
Marinobacter sp. ELB17	10	2
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
merT	Hahella chejuensis KCTC 2396	3 Marinobacter aqueolei* Site: position = -65 score = 6.35688 sequence = ACTCCGTACTTGACTACGGAAG Gene: Maqu_4013: Mercury uptake inner membane protein Site: position = -65 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: Maqu_0239: Mercury uptake inner membane protein Site: position = -65 score = 6.13309 sequence = ACTCCGTAGCTGACTACGGAAG Gene: Maqu_1394: Mercury uptake inner membane protein	* Marinobacter sp. ELB17 Site: position = -65 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: MELB17_00680: Mercury uptake inner membane protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Mercury uptake inner membane protein
merP	Hahella chejuensis KCTC 2396	3 Marinobacter aqueolei Gene: Maqu_4012: Periplasmic mercury(+2) binding protein Gene: Maqu_0240: Periplasmic mercury(+2) binding protein Gene: Maqu_1393: Periplasmic mercury(+2) binding protein	2 Marinobacter sp. ELB17* Site: position = -220 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: MELB17_23165: Periplasmic mercury(+2) binding protein Gene: MELB17_00675: Periplasmic mercury(+2) binding protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Periplasmic mercury(+2) binding protein
merF	Hahella chejuensis KCTC 2396	2 Marinobacter aqueolei Gene: Maqu_4011: Putative mercury resistance protein Gene: Maqu_0241: Putative mercury resistance protein	2 Marinobacter sp. ELB17 Gene: MELB17_23160: Putative mercury resistance protein Gene: MELB17_00670: Putative mercury resistance protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Putative mercury resistance protein
merA	Hahella chejuensis KCTC 2396	3 Marinobacter aqueolei Gene: Maqu_4010: Mercuric ion reductase (EC 1.16.1.1) Gene: Maqu_0242: Mercuric ion reductase (EC 1.16.1.1) Gene: Maqu_1392: Mercuric ion reductase (EC 1.16.1.1)	2 Marinobacter sp. ELB17 Gene: MELB17_23155: Mercuric ion reductase (EC 1.16.1.1) Gene: MELB17_00665: Mercuric ion reductase (EC 1.16.1.1)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Mercuric ion reductase (EC 1.16.1.1)
merB	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_0243: Organomercurial lyase (EC 4.99.1.2)	Marinobacter sp. ELB17 Gene: MELB17_00660: Organomercurial lyase (EC 4.99.1.2)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Organomercurial lyase (EC 4.99.1.2)
merD	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_00655: Mercuric resistance operon coregulator	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Mercuric resistance operon coregulator
merP2	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_23150: Periplasmic mercury(+2) binding protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Periplasmic mercury(+2) binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MerR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --