Regulog MerR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | 12 | 3 |
| Marinobacter sp. ELB17 | 10 | 2 |
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | ||
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| merT |
|
*3
Marinobacter aqueolei Site: position = -65 score = 6.35688 sequence = ACTCCGTACTTGACTACGGAAG Gene: Maqu_4013: Mercury uptake inner membane protein Site: position = -65 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: Maqu_0239: Mercury uptake inner membane protein Site: position = -65 score = 6.13309 sequence = ACTCCGTAGCTGACTACGGAAG Gene: Maqu_1394: Mercury uptake inner membane protein |
*
Marinobacter sp. ELB17 Site: position = -65 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: MELB17_00680: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP |
|
3
Marinobacter aqueolei Gene: Maqu_4012: Periplasmic mercury(+2) binding protein Gene: Maqu_0240: Periplasmic mercury(+2) binding protein Gene: Maqu_1393: Periplasmic mercury(+2) binding protein |
*2
Marinobacter sp. ELB17 Site: position = -220 score = 5.7026 sequence = ATTCCGTAGCTGACTACGGGAG Gene: MELB17_23165: Periplasmic mercury(+2) binding protein Gene: MELB17_00675: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
| merF |
|
2
Marinobacter aqueolei Gene: Maqu_4011: Putative mercury resistance protein Gene: Maqu_0241: Putative mercury resistance protein |
2
Marinobacter sp. ELB17 Gene: MELB17_23160: Putative mercury resistance protein Gene: MELB17_00670: Putative mercury resistance protein |
|
|
|
|
|
|
|
|
|
Putative mercury resistance protein |
| merA |
|
3
Marinobacter aqueolei Gene: Maqu_4010: Mercuric ion reductase (EC 1.16.1.1) Gene: Maqu_0242: Mercuric ion reductase (EC 1.16.1.1) Gene: Maqu_1392: Mercuric ion reductase (EC 1.16.1.1) |
2
Marinobacter sp. ELB17 Gene: MELB17_23155: Mercuric ion reductase (EC 1.16.1.1) Gene: MELB17_00665: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| merB |
|
Gene: Maqu_0243: Organomercurial lyase (EC 4.99.1.2) |
Gene: MELB17_00660: Organomercurial lyase (EC 4.99.1.2) |
|
|
|
|
|
|
|
|
|
Organomercurial lyase (EC 4.99.1.2) |
| merD |
|
|
Gene: MELB17_00655: Mercuric resistance operon coregulator |
|
|
|
|
|
|
|
|
|
Mercuric resistance operon coregulator |
| merP2 |
|
|
Gene: MELB17_23150: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |