Profile of regulator MerR in Oceanospirillales/Alteromonadales
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Regulog: | MerR - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Marinobacter aqueolei | |||||
| Maqu_1394 | merT | -65 | 6.1 | ACTCCGTAGCTGACTACGGAAG | |
| Maqu_4013 | merT | -65 | 6.4 | ACTCCGTACTTGACTACGGAAG | |
| Maqu_0239 | merT | -65 | 5.7 | ATTCCGTAGCTGACTACGGGAG | |
| Marinobacter sp. ELB17 | |||||
| MELB17_23165 | merP | -220 | 5.7 | ATTCCGTAGCTGACTACGGGAG | |
| MELB17_00680 | merT | -65 | 5.7 | ATTCCGTAGCTGACTACGGGAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |