Regulon of MerR in Marinobacter sp. ELB17

Properties
Regulator type:	Transcription factor
TF locus tag:	MELB17_23170, MELB17_00685
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -220 Score: 5.7 Sequence: ATTCCGTAGCTGACTACGGGAG Locus tag: MELB17_23165 Name: merP Funciton: Periplasmic mercury(+2) binding protein Locus tag: MELB17_23160 Name: merF Funciton: Putative mercury resistance protein Locus tag: MELB17_23155 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: MELB17_23150 Name: merP2 Funciton: Periplasmic mercury(+2) binding protein
	MELB17_23165	merP	Periplasmic mercury(+2) binding protein
	MELB17_23160	merF	Putative mercury resistance protein
	MELB17_23155	merA	Mercuric ion reductase (EC 1.16.1.1)
	MELB17_23150	merP2	Periplasmic mercury(+2) binding protein
Position: -65 Score: 5.7 Sequence: ATTCCGTAGCTGACTACGGGAG Locus tag: MELB17_00680 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: MELB17_00675 Name: merP Funciton: Periplasmic mercury(+2) binding protein Locus tag: MELB17_00670 Name: merF Funciton: Putative mercury resistance protein Locus tag: MELB17_00665 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: MELB17_00660 Name: merB Funciton: Organomercurial lyase (EC 4.99.1.2) Locus tag: MELB17_00655 Name: merD Funciton: Mercuric resistance operon coregulator
	MELB17_00680	merT	Mercury uptake inner membane protein
	MELB17_00675	merP	Periplasmic mercury(+2) binding protein
	MELB17_00670	merF	Putative mercury resistance protein
	MELB17_00665	merA	Mercuric ion reductase (EC 1.16.1.1)
	MELB17_00660	merB	Organomercurial lyase (EC 4.99.1.2)
	MELB17_00655	merD	Mercuric resistance operon coregulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD