Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merT gene

Properties
Regulog: MerR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Marinobacter aqueolei
Position: -65
Score: 6.13309
Sequence: ACTCCGTAGCTGACTACGGAAG
Locus tag: Maqu_1394
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Maqu_1393
Name: merP
Funciton: Periplasmic mercury(+2) binding protein
Locus tag: Maqu_1392
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
merT-merP-merA -65 6.1 ACTCCGTAGCTGACTACGGAAG Maqu_1394
Marinobacter sp. ELB17
Position: -65
Score: 5.7026
Sequence: ATTCCGTAGCTGACTACGGGAG
Locus tag: MELB17_00680
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: MELB17_00675
Name: merP
Funciton: Periplasmic mercury(+2) binding protein
Locus tag: MELB17_00670
Name: merF
Funciton: Putative mercury resistance protein
Locus tag: MELB17_00665
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: MELB17_00660
Name: merB
Funciton: Organomercurial lyase (EC 4.99.1.2)
Locus tag: MELB17_00655
Name: merD
Funciton: Mercuric resistance operon coregulator
merT-merP-merF-merA-merB-merD -65 5.7 ATTCCGTAGCTGACTACGGGAG MELB17_00680