Regulog CueR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1	3	2
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1	2	1
Rhodobacterales bacterium HTCC2654	2	2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597	3	2
Roseovarius nubinhibens ISM	2	2
Roseovarius sp. 217	10	5
Sulfitobacter sp. EE-36	2	1
Silicibacter TM1040
Silicibacter pomeroyi DSS-3	2	1
Roseobacter sp. MED193	4	2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
copZ	* Rhodobacter sphaeroides 2.4.1 Site: position = -123 score = 5.30264 sequence = GGCTTCCCACAACTGGAAGGT Gene: RSP_2891: Copper chaperone	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	2 Rhodobacterales bacterium HTCC2654* Site: position = -104 score = 5.27286 sequence = CCCTTCCAGTCACTGGAAGGT Gene: RB2654_14810: Copper chaperone Site: position = -60 score = 5.10873 sequence = ACCTTCCAGCGGGGGGAAGCC Gene: RB2654_22238: Copper chaperone	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53 Gene: SKA53_00015: Copper chaperone	* Oceanicola batsensis HTCC2597 Site: position = -60 score = 5.10873 sequence = ACCTTCCAGCGGGGGGAAGCC Gene: OB2597_16482: Copper chaperone	* Roseovarius nubinhibens ISM Site: position = -51 score = 5.1372 sequence = ACCTTCCCATAGGGGGACGGC Gene: ISM_17460: Copper chaperone	* Roseovarius sp. 217 Site: position = -103 score = 5.0862 sequence = GGCTTCCACCAACTGGAAGGT Gene: ROS217_03390: Copper chaperone	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Copper chaperone

CRON 2.
copA	* Rhodobacter sphaeroides 2.4.1 Site: position = -48 score = 5.30264 sequence = ACCTTCCAGTTGTGGGAAGCC Gene: RSP_2890: Copper-translocating P-type ATPase (EC 3.6.3.4)	Paracoccus denitrificans PD1222 Gene: Pden_0521: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Jannaschia sp. CCS1 Site: position = -54 score = 5.54911 sequence = AGCTTCCAGTCACTGGAAGGT Gene: Jann_2086: Copper-translocating P-type ATPase (EC 3.6.3.4)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_14850: Copper-translocating P-type ATPase (EC 3.6.3.4)	Oceanicola granulosus HTCC2516 Gene: OG2516_15329: Copper-translocating P-type ATPase (EC 3.6.3.4)	Loktanella vestfoldensis SKA53 Gene: SKA53_00020: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Oceanicola batsensis HTCC2597 Site: position = -58 score = 4.78538 sequence = ACCCTCCAGTAACTGGAAGCC Gene: OB2597_16487: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Roseovarius nubinhibens ISM Site: position = -128 score = 5.03155 sequence = ACCTTCCAGTTGCTGGAAGCC Gene: ISM_17435: Copper-translocating P-type ATPase (EC 3.6.3.4)	3 Roseovarius sp. 217* Site: position = -55 score = 5.0862 sequence = ACCTTCCAGTTGGTGGAAGCC Gene: ROS217_03395: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -192 score = 4.3433 sequence = ACCTTACAGTGACTGGAATCC Gene: ROS217_07749: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -61 score = 4.76169 sequence = ACCTTCCAGTTACAGGAACCT Gene: ROS217_02315: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Sulfitobacter sp. EE-36 Site: position = -114 score = 4.97128 sequence = ACCTTCCATTAACTGGAAGCC Gene: EE36_05438: Copper-translocating P-type ATPase (EC 3.6.3.4)	Silicibacter TM1040 Gene: TM1040_2080: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Silicibacter pomeroyi DSS-3 Site: position = -58 score = 4.74607 sequence = ACCTTCCCGTGACTGGAACCC Gene: SPO0794: Copper-translocating P-type ATPase (EC 3.6.3.4)	2 Roseobacter sp. MED193* Site: position = -62 score = 4.98447 sequence = ACCTTCCCCTAACTGGAGGCC Gene: MED193_18159: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -36 score = 4.68391 sequence = ACCTTCCGGTAACTGGAAGCC Gene: MED193_02420: Copper-translocating P-type ATPase (EC 3.6.3.4)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2889: Copper-responsive transcriptional regulator, MerR family	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_2087: Copper-responsive transcriptional regulator, MerR family	Rhodobacterales bacterium HTCC2654 Gene: RB2654_14855: Copper-responsive transcriptional regulator, MerR family	Oceanicola granulosus HTCC2516 Gene: OG2516_15334: Copper-responsive transcriptional regulator, MerR family	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597 Gene: OB2597_16492: Copper-responsive transcriptional regulator, MerR family	Roseovarius nubinhibens ISM	4 Roseovarius sp. 217* Gene: ROS217_07754: Copper-responsive transcriptional regulator, MerR family Site: position = -49 score = 5.23292 sequence = ACCTTCCATCTACTGGAAGGA Gene: ROS217_02505: Copper-responsive transcriptional regulator, MerR family Gene: ROS217_02320: Copper-responsive transcriptional regulator, MerR family Gene: ROS217_03400: Copper-responsive transcriptional regulator, MerR family	Sulfitobacter sp. EE-36 Gene: EE36_05433: Copper-responsive transcriptional regulator, MerR family	Silicibacter TM1040 Gene: TM1040_0537: Copper-responsive transcriptional regulator, MerR family	Silicibacter pomeroyi DSS-3 Gene: SPO0793: Copper-responsive transcriptional regulator, MerR family	2 Roseobacter sp. MED193 Gene: MED193_02425: Copper-responsive transcriptional regulator, MerR family Gene: MED193_18164: Copper-responsive transcriptional regulator, MerR family	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Copper-responsive transcriptional regulator, MerR family
PF07885	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_03405: Hypothetical membrane protein	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Hypothetical membrane protein
ROS217_02325	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_02325: hypothetical protein	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CueR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --