Regulon of CueR in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_14855
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.3 Sequence: CCCTTCCAGTCACTGGAAGGT Locus tag: RB2654_14810 Name: copZ Funciton: Copper chaperone
	RB2654_14810	copZ	Copper chaperone
Position: -60 Score: 5.1 Sequence: ACCTTCCAGCGGGGGGAAGCC Locus tag: RB2654_22238 Name: copZ Funciton: Copper chaperone
	RB2654_22238	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD