Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ROS217_02325 gene

Properties
Regulog: CueR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Built upon 18 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseovarius sp. 217
Position: -61
Score: 4.76169
Sequence: ACCTTCCAGTTACAGGAACCT
Locus tag: ROS217_02315
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: ROS217_02320
Name: cueR
Funciton: Copper-responsive transcriptional regulator, MerR family
Locus tag: ROS217_02325
Name: null
Funciton: hypothetical protein
copA-cueR-ROS217_02325 -61 4.8 ACCTTCCAGTTACAGGAACCT ROS217_02315
© 2009-2020 RegPrecise