Regulon of CueR in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2597_09094, OB2597_16492
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 4.8 Sequence: ACCCTCCAGTAACTGGAAGCC Locus tag: OB2597_16487 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: OB2597_16492 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	OB2597_16487	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	OB2597_16492	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -60 Score: 5.1 Sequence: ACCTTCCAGCGGGGGGAAGCC Locus tag: OB2597_16482 Name: copZ Funciton: Copper chaperone
	OB2597_16482	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD