Regulon of CueR in Roseovarius sp. 217

Properties
Regulator type:	Transcription factor
TF locus tag:	ROS217_02505, ROS217_03400, ROS217_02320, ROS217_07754
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhodobacterales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -192 Score: 4.3 Sequence: ACCTTACAGTGACTGGAATCC Locus tag: ROS217_07749 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: ROS217_07754 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	ROS217_07749	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	ROS217_07754	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -103 Score: 5.1 Sequence: GGCTTCCACCAACTGGAAGGT Locus tag: ROS217_03390 Name: copZ Funciton: Copper chaperone
	ROS217_03390	copZ	Copper chaperone
Position: -55 Score: 5.1 Sequence: ACCTTCCAGTTGGTGGAAGCC Locus tag: ROS217_03395 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: ROS217_03400 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family Locus tag: ROS217_03405 Name: PF07885 Funciton: Hypothetical membrane protein
	ROS217_03395	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	ROS217_03400	cueR	Copper-responsive transcriptional regulator, MerR family
	ROS217_03405	PF07885	Hypothetical membrane protein
Position: -49 Score: 5.2 Sequence: ACCTTCCATCTACTGGAAGGA Locus tag: ROS217_02505 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	ROS217_02505	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -61 Score: 4.8 Sequence: ACCTTCCAGTTACAGGAACCT Locus tag: ROS217_02315 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: ROS217_02320 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family Locus tag: ROS217_02325 Name: null Funciton: hypothetical protein
	ROS217_02315	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	ROS217_02320	cueR	Copper-responsive transcriptional regulator, MerR family
	ROS217_02325		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD