Regulog CueR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | 1 | 1 |
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia sp. 383 | 1 | 1 |
| Burkholderia cepacia AMMD | 1 | 1 |
| Burkholderia vietnamiensis G4 | 5 | 4 |
| Burkholderia glumae BGR1 | ||
| Burkholderia xenovorans LB400 | 3 | 3 |
| Burkholderia phymatum STM815 | 2 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| copZ |
*
Burkholderia pseudomallei K96243 Site: position = -11 score = 5.60479 sequence = ACCTTCCCACAGTGGGAAGAT Gene: BPSL0301: Copper chaperone |
|
*
Burkholderia sp. 383 Site: position = -64 score = 5.76666 sequence = ACCTTCCCACCGTGGCAAGCT Gene: Bcep18194_A6338: Copper chaperone |
*
Burkholderia cepacia AMMD Site: position = -64 score = 5.85162 sequence = ACCTTCCCACCATGGCAAGCT Gene: Bamb_3036: Copper chaperone |
*3
Burkholderia vietnamiensis G4 Site: position = -64 score = 5.85162 sequence = ACCTTCCCACCATGGCAAGCT Gene: Bcep1808_3075: Copper chaperone Gene: Bcep1808_7186: Copper chaperone Site: position = -32 score = 5.63209 sequence = ACCTTCCCATCGTTGGAACGT Gene: Bcep1808_7262: Copper chaperone |
|
*2
Burkholderia xenovorans LB400 Site: position = -90 score = 6.18468 sequence = ACCTTGCCATCATGGGAAGGT Gene: Bxe_A3162: Copper chaperone Site: position = -58 score = 5.83931 sequence = ACCTTACCGCCGTGGGAAGGT Gene: Bxe_B2298: Copper chaperone |
*
Burkholderia phymatum STM815 Site: position = -89 score = 6.20645 sequence = ACCTTCCCACTGTGGGAAGGT Gene: Bphy_1968: Copper chaperone |
Copper chaperone |
| CRON 2. | |||||||||
| cueR2 |
|
|
|
|
*3
Burkholderia vietnamiensis G4 Gene: Bcep1808_7261: Copper-responsive transcriptional regulator, MerR family Site: position = -26 score = 6.2914 sequence = ACCTTCCCATAGTGGGAAGGT Gene: Bcep1808_3973: Copper-responsive transcriptional regulator, MerR family Site: position = -69 score = 5.70044 sequence = ACCTTCCCAACGTGGGAAGGT Gene: Bcep1808_7183: Copper-responsive transcriptional regulator, MerR family |
|
|
|
Copper-responsive transcriptional regulator, MerR family |
| copA2 |
|
|
|
|
2
Burkholderia vietnamiensis G4 Gene: Bcep1808_3972: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: Bcep1808_7191: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| CRON 3. | |||||||||
| cueR |
Gene: BPSS0351: Copper-responsive transcriptional regulator, MerR family |
|
Gene: Bcep18194_A5545: Copper-responsive transcriptional regulator, MerR family |
Gene: Bamb_2255: Copper-responsive transcriptional regulator, MerR family |
Gene: Bcep1808_2302: Copper-responsive transcriptional regulator, MerR family |
Gene: bglu_1g25600: Copper-responsive transcriptional regulator, MerR family |
*
Burkholderia xenovorans LB400 Site: position = -8 score = 6.18468 sequence = ACCTTCCCATGATGGCAAGGT Gene: Bxe_A3161: Copper-responsive transcriptional regulator, MerR family |
*
Burkholderia phymatum STM815 Site: position = -64 score = 6.20645 sequence = ACCTTCCCACAGTGGGAAGGT Gene: Bphy_1967: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |