Regulon of CueR in Burkholderia vietnamiensis G4

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep1808_2302, Bcep1808_7183, Bcep1808_7261, Bcep1808_3973
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -26 Score: 6.3 Sequence: ACCTTCCCATAGTGGGAAGGT Locus tag: Bcep1808_3973 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family Locus tag: Bcep1808_3972 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Bcep1808_3973	cueR2	Copper-responsive transcriptional regulator, MerR family
	Bcep1808_3972	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -69 Score: 5.7 Sequence: ACCTTCCCAACGTGGGAAGGT Locus tag: Bcep1808_7183 Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
	Bcep1808_7183	cueR2	Copper-responsive transcriptional regulator, MerR family
Position: -32 Score: 5.6 Sequence: ACCTTCCCATCGTTGGAACGT Locus tag: Bcep1808_7262 Name: copZ Funciton: Copper chaperone
	Bcep1808_7262	copZ	Copper chaperone
Position: -64 Score: 5.9 Sequence: ACCTTCCCACCATGGCAAGCT Locus tag: Bcep1808_3075 Name: copZ Funciton: Copper chaperone
	Bcep1808_3075	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD