Regulon of CueR in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_2255
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Burkholderia
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.9 Sequence: ACCTTCCCACCATGGCAAGCT Locus tag: Bamb_3036 Name: copZ Funciton: Copper chaperone
	Bamb_3036	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD