Regulon of CueR in Burkholderia sp. 383
| Regulator type: | Transcription factor |
| TF locus tag: | Bcep18194_A5545 |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Regulog: | CueR - Burkholderia |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -64
Score: 5.8 Sequence: ACCTTCCCACCGTGGCAAGCT
Locus tag: Bcep18194_A6338
Name: copZ Funciton: Copper chaperone |
|||
|
copZ
|
Copper chaperone
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |