Regulon of CueR in Burkholderia pseudomallei K96243

Properties
Regulator type:	Transcription factor
TF locus tag:	BPSS0351
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Burkholderia
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -11 Score: 5.6 Sequence: ACCTTCCCACAGTGGGAAGAT Locus tag: BPSL0301 Name: copZ Funciton: Copper chaperone
	BPSL0301	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD