Regulog SoxR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36	1	1
Aeromonas hydrophila subsp. hydrophila ATCC 7966	1	1
Aeromonas salmonicida subsp. salmonicida A449	1	1
Tolumonas auensis DSM 9187

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
PF07690	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	* Moritella sp. PE36 Site: position = -141 score = 6.42356 sequence = ACCTCAACATAACTTGAGGT Gene: PE36_09311: Permease of the major facilitator superfamily	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Permease of the major facilitator superfamily

CRON 2.
AHA_2711	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	* Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -61 score = 5.3425 sequence = ACCTCAAGTTAGCTTTAACT Gene: AHA_2711: hypothetical protein	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -55 score = 5.3425 sequence = ACCTCAAGTTAGCTTTAACT Gene: ASA_1662: hypothetical protein	Tolumonas auensis DSM 9187	hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --