Regulog SoxR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | 1 | 1 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 1 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 1 | 1 |
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| PF07690 |
|
|
*
Moritella sp. PE36 Site: position = -141 score = 6.42356 sequence = ACCTCAACATAACTTGAGGT Gene: PE36_09311: Permease of the major facilitator superfamily |
|
|
|
Permease of the major facilitator superfamily |
| CRON 2. | |||||||
| AHA_2711 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -61 score = 5.3425 sequence = ACCTCAAGTTAGCTTTAACT Gene: AHA_2711: hypothetical protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -55 score = 5.3425 sequence = ACCTCAAGTTAGCTTTAACT Gene: ASA_1662: hypothetical protein |
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |